Mature sequence mja-miR-6493-3p

Accession numberMIMAT0025302
IDmja-miR-6493-3p
Stem-Loop mja-mir-6493
Sequence
agggggaaaccgcgcugagcguua
Get sequence
Deep sequencing reads, experiments

References

1