Mature sequence mja-miR-6494

Accession numberMIMAT0025303
IDmja-miR-6494
Stem-Loop mja-mir-6494
Sequence
agggcgcgguggugagcgua
Get sequence
Deep sequencing reads, experiments

References

1