Mature sequence hsa-miR-548az-5p

Accession numberMIMAT0025456
IDhsa-miR-548az-5p
Stem-Loop hsa-mir-548az
Sequence
caaaagugauugugguuuuugc
Get sequence
Deep sequencing5373 reads, 153 experiments
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).