Mature sequence mdm-miR172g

Accession numberMIMAT0025958
IDmdm-miR172g
Stem-Loop mdm-MIR172g
Sequence
agaaucuugaugaugcugcau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).