Mature sequence mtr-miR156g-3p

Accession numberMIMAT0026728
IDmtr-miR156g-3p
Stem-Loop mtr-MIR156g
Sequence
gcucucuagacuucugucauc
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).