Mature sequence mdo-miR-1548-5p

Accession numberMIMAT0026772
IDmdo-miR-1548-5p
Stem-Loop mdo-mir-1548
Sequence
agggcuccagcgggcacgcacgc
Get sequence
Deep sequencing4490 reads, 2 experiments
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).