Mature sequence gga-miR-1559-3p

Accession numberMIMAT0026775
IDgga-miR-1559-3p
Stem-Loop gga-mir-1559
Sequence
aguuacauguaugcaucgagca
Get sequence
Deep sequencing22 reads, 4 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).