Mature sequence gga-miR-2131-3p

Accession numberMIMAT0026920
IDgga-miR-2131-3p
Stem-Loop gga-mir-2131
Sequence
cuguuacuguucuucugaugg
Get sequence
Deep sequencing9602 reads, 5 experiments
Predicted targets

References

1
PMID:19328789 "High throughput sequencing of microRNAs in chicken somites" Rathjen T, Pais H, Sweetman D, Moulton V, Munsterberg A, Dalmay T FEBS Lett. 583:1422-1426(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).