Mature sequence ppe-miR171b

Accession numberMIMAT0027309
IDppe-miR171b
Stem-Loop ppe-MIR171b
Sequence
uugagccgcgccaauaucacu
Get sequence
Deep sequencing reads, experiments

References

1