Mature sequence ppe-miR171c

Accession numberMIMAT0027323
IDppe-miR171c
Stem-Loop ppe-MIR171c
Sequence
ugauugagccgugccaauauc
Get sequence
Deep sequencing reads, experiments

References

1