Mature sequence mmu-miR-7115-5p

Accession numberMIMAT0028127
IDmmu-miR-7115-5p
Stem-Loop mmu-mir-7115
Sequence
ucggggguuguggugccgaauugu
Get sequence
Deep sequencing24 reads, 19 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).