Mature sequence mes-miR169m

Accession numberMIMAT0029221
IDmes-miR169m
Stem-Loop mes-MIR169m
Sequence
cagccaagaaugacuugccgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).