Mature sequence ipu-miR-101a

Accession numberMIMAT0029386
IDipu-miR-101a
Stem-Loop ipu-mir-101a
Sequence
uacaguacugugauaacugaag
Get sequence
Deep sequencing reads, experiments

References

1