Mature sequence ipu-miR-10b

Accession numberMIMAT0029392
IDipu-miR-10b
Stem-Loop ipu-mir-10b-1 ipu-mir-10b-2
Sequence
uacccuguagaaccgaauuugu
Get sequence
Deep sequencing reads, experiments

References

1