Mature sequence ipu-miR-126a

Accession numberMIMAT0029400
IDipu-miR-126a
Stem-Loop ipu-mir-126a
Sequence
ucguaccgugaguaauaaugca
Get sequence
Deep sequencing reads, experiments

References

1