Mature sequence ipu-miR-133b

Accession numberMIMAT0029408
IDipu-miR-133b
Stem-Loop ipu-mir-133b
Sequence
uuugguccccuucaaccagcu
Get sequence
Deep sequencing reads, experiments

References

1