Mature sequence ipu-miR-148

Accession numberMIMAT0029425
IDipu-miR-148
Stem-Loop ipu-mir-148
Sequence
ucagugcauuacagaacuuugu
Get sequence
Deep sequencing reads, experiments

References

1