Mature sequence ipu-miR-153b

Accession numberMIMAT0029428
IDipu-miR-153b
Stem-Loop ipu-mir-153b
Sequence
uugcauagucacaaaaaugagc
Get sequence
Deep sequencing reads, experiments

References

1