Mature sequence ipu-miR-155

Accession numberMIMAT0029429
IDipu-miR-155
Stem-Loop ipu-mir-155
Sequence
uuaaugcuaaucgugauagggguu
Get sequence
Deep sequencing reads, experiments

References

1