Mature sequence ipu-miR-16b

Accession numberMIMAT0029432
IDipu-miR-16b
Stem-Loop ipu-mir-16b
Sequence
uagcagcacguaaauauuggag
Get sequence
Deep sequencing reads, experiments

References

1