Mature sequence ipu-miR-17b

Accession numberMIMAT0029435
IDipu-miR-17b
Stem-Loop ipu-mir-17b
Sequence
acugcaguggaggcacuucaagc
Get sequence
Deep sequencing reads, experiments

References

1