Mature sequence ipu-miR-181a

Accession numberMIMAT0029436
IDipu-miR-181a
Stem-Loop ipu-mir-181a-1 ipu-mir-181a-2 ipu-mir-181a-3 ipu-mir-181a-4 ipu-mir-181a-5
Sequence
aacauucaacgcugucggugag
Get sequence
Deep sequencing reads, experiments

References

1