Mature sequence ipu-miR-19a

Accession numberMIMAT0029451
IDipu-miR-19a
Stem-Loop ipu-mir-19a-1 ipu-mir-19a-2
Sequence
aguuuugcauaguugcacuac
Get sequence
Deep sequencing reads, experiments

References

1