Mature sequence ipu-miR-200a

Accession numberMIMAT0029453
IDipu-miR-200a
Stem-Loop ipu-mir-200a
Sequence
uaacacugucugguaacgaug
Get sequence
Deep sequencing reads, experiments

References

1