Mature sequence ipu-miR-203a

Accession numberMIMAT0029457
IDipu-miR-203a
Stem-Loop ipu-mir-203a
Sequence
agugguucuuaacaguucaaca
Get sequence
Deep sequencing reads, experiments

References

1