Mature sequence ipu-miR-204

Accession numberMIMAT0029459
IDipu-miR-204
Stem-Loop ipu-mir-204-2 ipu-mir-204-3 ipu-mir-204-1
Sequence
uucccuuugucauccuaugccu
Get sequence
Deep sequencing reads, experiments

References

1