Mature sequence ipu-miR-206

Accession numberMIMAT0029461
IDipu-miR-206
Stem-Loop ipu-mir-206-1 ipu-mir-206-2
Sequence
uggaauguaaggaagugugugg
Get sequence
Deep sequencing reads, experiments

References

1