Mature sequence ipu-miR-216a

Accession numberMIMAT0029467
IDipu-miR-216a
Stem-Loop ipu-mir-216a
Sequence
uaaucucagcuggcaacuguga
Get sequence
Deep sequencing reads, experiments

References

1