Mature sequence ipu-miR-218a

Accession numberMIMAT0029472
IDipu-miR-218a
Stem-Loop ipu-mir-218a-1 ipu-mir-218a-2
Sequence
uugugcuugaucuaaccaug
Get sequence
Deep sequencing reads, experiments

References

1