Mature sequence ipu-miR-223

Accession numberMIMAT0029478
IDipu-miR-223
Stem-Loop ipu-mir-223
Sequence
gaguauuugacagacugugg
Get sequence
Deep sequencing reads, experiments

References

1