Mature sequence ipu-miR-23b

Accession numberMIMAT0029482
IDipu-miR-23b
Stem-Loop ipu-mir-23b-2 ipu-mir-23b-1
Sequence
aucacauugccagggauuacc
Get sequence
Deep sequencing reads, experiments

References

1