Mature sequence ipu-miR-27c

Accession numberMIMAT0029489
IDipu-miR-27c
Stem-Loop ipu-mir-27c
Sequence
uucacagugguuaaguucug
Get sequence
Deep sequencing reads, experiments

References

1