Mature sequence ipu-miR-27e

Accession numberMIMAT0029491
IDipu-miR-27e
Stem-Loop ipu-mir-27e
Sequence
uucacaguggcuaaguucagu
Get sequence
Deep sequencing reads, experiments

References

1