Mature sequence ipu-miR-29b

Accession numberMIMAT0029493
IDipu-miR-29b
Stem-Loop ipu-mir-29b
Sequence
gcugaauucagauggugccauaga
Get sequence
Deep sequencing reads, experiments

References

1