Mature sequence ipu-miR-375

Accession numberMIMAT0029508
IDipu-miR-375
Stem-Loop ipu-mir-375-1 ipu-mir-375-2
Sequence
uuuguucguucggcucgcguu
Get sequence
Deep sequencing reads, experiments

References

1