Mature sequence ipu-miR-429a

Accession numberMIMAT0029509
IDipu-miR-429a
Stem-Loop ipu-mir-429a
Sequence
uaauacugucugguaaugccg
Get sequence
Deep sequencing reads, experiments

References

1