Mature sequence ipu-miR-92a

Accession numberMIMAT0029529
IDipu-miR-92a
Stem-Loop ipu-mir-92a-2 ipu-mir-92a-1
Sequence
uauugcacuugucccggccugu
Get sequence
Deep sequencing reads, experiments

References

1