Mature sequence ipu-miR-99a

Accession numberMIMAT0029532
IDipu-miR-99a
Stem-Loop ipu-mir-99a
Sequence
aacccguagauccgaucuugug
Get sequence
Deep sequencing reads, experiments

References

1