Mature sequence ipu-miR-16c

Accession numberMIMAT0029538
IDipu-miR-16c
Stem-Loop ipu-mir-16c
Sequence
ccagcagcacggucaauacug
Get sequence
Deep sequencing reads, experiments

References

1