Mature sequence ipu-miR-203c

Accession numberMIMAT0029541
IDipu-miR-203c
Stem-Loop ipu-mir-203c
Sequence
uugaacuguuaagaaccacugc
Get sequence
Deep sequencing reads, experiments

References

1