Mature sequence ipu-miR-7556

Accession numberMIMAT0029552
IDipu-miR-7556
Stem-Loop ipu-mir-7556
Sequence
uacaguaacuugaagacaacgu
Get sequence
Deep sequencing reads, experiments

References

1