Mature sequence ipu-miR-7561

Accession numberMIMAT0029558
IDipu-miR-7561
Stem-Loop ipu-mir-7561
Sequence
ugauucagagucgagcucgcuu
Get sequence
Deep sequencing reads, experiments

References

1