Mature sequence ipu-miR-7569

Accession numberMIMAT0029568
IDipu-miR-7569
Stem-Loop ipu-mir-7569
Sequence
uauaaucuugauguuucucca
Get sequence
Deep sequencing reads, experiments

References

1