Mature sequence ipu-miR-7572

Accession numberMIMAT0029571
IDipu-miR-7572
Stem-Loop ipu-mir-7572
Sequence
gauugcagcuuuacaguguuucc
Get sequence
Deep sequencing reads, experiments

References

1