Mature sequence mmu-miR-7663-3p

Accession numberMIMAT0029833
IDmmu-miR-7663-3p
Stem-Loop mmu-mir-7663
Sequence
aguguggaucauaaggagcucc
Get sequence
Deep sequencing33 reads, 16 experiments
Predicted targets

References

1