Mature sequence mmu-miR-126b-5p

Accession numberMIMAT0029894
IDmmu-miR-126b-5p
Stem-Loop mmu-mir-126b
Sequence
auuauuacucacgguacgaguu
Get sequence
Deep sequencing14 reads, 6 experiments
Predicted targets

References

1