Mature sequence gga-miR-135a-1-3p

Accession numberMIMAT0031036
IDgga-miR-135a-1-3p
Stem-Loop gga-mir-135a-1
Sequence
auauagggauugaagccgugca
Get sequence
Deep sequencing2668 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).