Mature sequence aly-miR166h-3p

Accession numberMIMAT0031383
IDaly-miR166h-3p
Stem-Loop aly-MIR166h
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing134 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).