Mature sequence cel-lsy-6-5p

Accession numberMIMAT0031896
IDcel-lsy-6-5p
Stem-Loop cel-lsy-6
Sequence
aaaugcgucuaguaucaaaau
Get sequence
Deep sequencing reads, experiments

References

1
2
3
4
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).