Mature sequence dre-miR-125b-2-3p

Accession numberMIMAT0031964
IDdre-miR-125b-2-3p
Stem-Loop dre-mir-125b-2
Sequence
cggguuggguucucgggagcu
Get sequence
Deep sequencing427 reads, 11 experiments
Database links
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).